#CPEB4
Gracias @20minutos.es por divulgar nuestro trabajo sobre un primer paso hacia terapias capaces de corregir CPEB4 en el #Autismo
Una investigación del @cbm-csic-uam.bsky.social colaboración entre nuestro laboratorio y el de Lourdes Ruiz Desviat. @mirimiam.bsky.social
www.20minutos.es/capaces/inve...
Investigadores españoles logran diseñar unas moléculas que 'reparan' en el laboratorio una alteración frecuente en el autismo
Es solo una prueba de concepto llevada a cabo en un modelo celular, pero este estudio constituye un primer paso hacia su posible uso terapéutico
www.20minutos.es
November 2, 2025 at 11:02 AM
Ahora que se acerca el final del año, toca hacer balance. #SoyAutista

Aquí algunas cosas positivas y negativas que han sucedido. ¡Podéis poner las vuestras!

En resumen, ha sido un buen año para divulgar y tejer redes, pero el capacitismo y la eugenesia crece como la espuma+
December 30, 2024 at 8:11 PM
#PCBCommunity | A team of scientists, led by Raúl Méndez & @xsalvatella1.bsky.social, at @irbbarcelona.bsky.social has identified a molecular mechanism that explains why certain alternations of the neuronal protein #CPEB4 are associated with idiopathic #autism.

📝 @natureportfolio.bsky.social
🫧🔍Key breakthrough in #autism: pivotal role of #CPEB4 condensates revealed.

💊The study opens new avenues for the development of targeted treatments for autism.

📰 Nature @natureportfolio.bsky.social

✍️ Carla Garcia-Cabau, Anna Bartomeu et al.

➡️ bit.ly/3BfEGlR

📌 DOI: 10.1038/s41586-024-08289-w
December 5, 2024 at 4:38 PM
Hoy en @20minutos.es entrevistamos a José Lucas del CBM Severo Ochoa del @csic.es, integrante esencial del hallazgo que relaciona la proteína CPEB4 y el #autismo: "Una legión de investigadores nos dejamos el pellejo en generar conocimiento que tendrá aplicabilidad" www.20minutos.es/noticia/5664...
ENTREVISTA | José Javier Lucas: "Encontrar terapias para el autismo nos mueve a todos, a los investigadores también"
El profesor Lucas es parte esencial del prometedor hallazgo que relaciona la proteína CPEB4 y el autismo: "Una legión de investigadores nos dejamos el pellejo en generar conocimiento que tendrá una ap...
www.20minutos.es
December 20, 2024 at 8:05 AM
@irbbarcelona.bsky.social ha identificat 1 mecanisme molecular que explica perquè certes alteracions a la proteïna neuronal CPEB4 estan associades a l'autisme idiopàtic
🔗https://www.irbbarcelona.org/ca/news/cientifiques/avenc-clau-en-autisme-descobert-el-paper-crucial-dels-condensats-de-la-pro
teina
December 5, 2024 at 5:30 PM
…such as a GATA1-dependent regulatory network comprising the CPEB4 gene and an enhancer harboring variants with multiple associations to blood cell traits, exemplifying how Perturb-multiome can help systematically pinpoint associations between phenotypes and GWAS variants. (9/n)
April 3, 2025 at 9:20 PM
Lucas'lab reports in @ScienceTM that CPEB1/CPEB4 alteration in HD patients causes a shift in poliadenylation, which affects the expression of thiamine transporter. Biotin and thiamine supplementation improves neuropathological features in HD mice 👏👏

bit.ly/3m5FD4A
November 27, 2024 at 3:23 PM
A variant of the protein CPEB4, which regulates autism-linked genes, forms irreversible clumps in some autistic people, impairing its function, a new study suggests.

By @giorgiag-sciwriter.bsky.social

#neuroskyence

www.thetransmitter.org/spectrum/pro...
Protein aggregates gum up ‘master regulator’ of autism-linked genes
The regulator, CPEB4, typically controls protein production for hundreds of autism-linked genes, but an alternative version of it found in autistic people forms irreversible clumps and malfunctions.
www.thetransmitter.org
January 23, 2025 at 3:02 PM
New findings from IRB show CPEB4 condensates disrupt synaptic processes by 40% in autism, offering new therapeutic targets #autism #CPEB4
go.nature.com/4fZhKq9
Mis-splicing of a neuronal microexon promotes CPEB4 aggregation in ASD - Nature
The molecular mechanisms of how small changes in the degree of inclusion of a neuron-specific microexon in CPEB4 lead to dominant-negative effects in the expression of genes associated with autism spe...
go.nature.com
December 5, 2024 at 4:03 PM
Very nice Spotlight by JR Huang on our recent paper on the link between CPEB4 aggregation and ASD : Microexon in action: How tiny fragments in a protein tune function, drive disease: Molecular Cell www.cell.com/molecular-ce.... Thank you for highlighting our work !
Microexon in action: How tiny fragments in a protein tune function, drive disease
Intrinsically disordered regions (IDRs) of proteins can regulate function through phase separation. In a recent article in Nature, Garcia-Cabau et al. reveal that including or excluding a microexon wi...
www.cell.com
January 18, 2025 at 8:53 PM
Aquesta sensibilitat es perd quan falta el segment de 8aa en la proteïna CPEB4. Un petit canvi amb una gran repercussió, una mena d’ona expansiva q esdevé silenciada.
December 5, 2024 at 1:56 PM
Sembla que el segment de 8 aa de CPEB4 es perderia durant l’embaràs,
en l'etapa de desenvolupament embrionari que dóna lloc a la formació  del cervell.
December 5, 2024 at 1:56 PM
Científicos catalanes descubren un mecanismo que podría causar parte de los casos de autismo: el estudio revela cómo la falta de un segmento en la proteína CPEB4 disminuye la expresión de genes cruciales para el desarrollo neuronal
https://ver.tw/98nnr4
Científicos catalanes descubren un mecanismo que podría causar parte de los casos de autismo
Un estudio del Institut de Recerca Biomèdica Barcelona (IRB) ha descubierto un mecanismo molecular relacionado con "ciertas alteraciones en la prote
ver.tw
December 9, 2024 at 7:30 AM
24 harf departmanından.

GCAAGGACATATGGGCGAAGGAGA: Otizm ile ilişkili 24 DNA harfi.

Bu harfler beyin gelişimi için önemli olan bir proteinin (CPEB4) küçük bir parçasının kaybını temsil ediyor. Ve otizmi tersine çevirmenin anahtarı olabileceğine inanıyorlar.
Dahası👇
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders
english.elpais.com
December 6, 2024 at 3:02 PM
Mis-splicing of a 24-nt neuronal microexon in CPEB4 is linked to autism, affecting protein aggregation and translation regulation. PMID:39633052, Nature 2025, @Nature https://doi.org/10.1038/s41586-024-08289-w #Medsky #Pharmsky #RNA #ASHG #ESHG 🧪
Mis-splicing of a neuronal microexon promotes CPEB4 aggregation in ASD | Nature
The inclusion of microexons by alternative splicing occurs frequently in neuronal proteins. The roles of these sequences are largely unknown, and changes in their degree of inclusion are associated with neurodevelopmental disorders1. We have previously shown that decreased inclusion of a 24-nucleotide neuron-specific microexon in CPEB4, a RNA-binding protein that regulates translation through cytoplasmic changes in poly(A) tail length, is linked to idiopathic autism spectrum disorder (ASD)2. Why this microexon is required and how small changes in its degree of inclusion have a dominant-negative effect on the expression of ASD-linked genes is unclear. Here we show that neuronal CPEB4 forms condensates that dissolve after depolarization, a transition associated with a switch from translational repression to activation. Heterotypic interactions between the microexon and a cluster of histidine residues prevent the irreversible aggregation of CPEB4 by competing with homotypic interacti
doi.org
March 26, 2025 at 6:50 AM
Avenç clau en autisme: descobert el paper crucial dels condensats de la proteïna #CPEB4 La manca del microexó en CPEB4 afavoreix l'evolució dels condensats en agregats. www.irbbarcelona.org/ca/news/cien...
December 4, 2024 at 5:46 PM
CIENCIA. Una pequeña pieza faltante de la proteína CPEB4, que se mueve por la célula y ayuda a regular la expresión genética, puede afectar la actividad neuronal y provocar síntomas del trastorno del espectro autista www.cronicadelhenares.com/2024/12/cien...
CIENCIA. Cambios en la proteína CBEP4 vinculados al autismo
ciencia, autismo
www.cronicadelhenares.com
December 4, 2024 at 8:59 PM
The work published today in Nature reveals that this small fragment is key for neuronal activity because it preserves the flexibility of #CPEB4 to assemble into condensates and disassemble them.
December 4, 2024 at 4:00 PM
Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!

english.elpais.com/science-tech...
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders
english.elpais.com
December 5, 2024 at 11:50 AM
O novo estudo se baseia em uma pesquisa d 2018 q revelou a perda d um fragmento d DNA, conhecido como microéxon, em pessoas com autismo. Esse microéxon é responsável por codificar um segmento da proteína CPEB4 que não possui estrutura fixa, mas q desempenha um papel essencial em processos celulares.
Cientistas descobrem mecanismo genético que se conectaria com até 80% dos casos de autismo
Descoberta sobre a proteína CPEB4 revela novos caminhos.
br.ign.com
December 6, 2024 at 7:24 PM
Researchers at IRB Barcelona have linked CPEB4 protein alterations to idiopathic autism, revealing potential therapeutic avenues by restoring protein function. Further studies are needed for clinical application.
Autism study reveals pivotal role of neuronal protein CPEB4 condensates
Autism is a neurodevelopmental disorder characterized by difficulties in communication and social behavior. Approximately 20% of cases are linked to a specific genetic mutation, but the origin of the remaining 80%, known as idiopathic autism, remains a mystery.
medicalxpress.com
December 4, 2024 at 4:03 PM
✒️Nueva newsletter

A raíz de todas las preguntas que me habéis hecho alrededor del último estudio sobre autismo, he intentado responder a todas ellas. #Soyautista

¿Sería “realmente” posible una cura para el autismo?

¿Por qué estudiaron esa proteína (CPEB4) y no otra?

¿Hay ratones autistas?

...
December 15, 2024 at 10:19 PM
CPEB4 actúa unint-se als mRNAs corresponents, de manera que regula de manera exquisita i a temps real la seva activació.
December 5, 2024 at 1:56 PM
🫧🔍Key breakthrough in #autism: pivotal role of #CPEB4 condensates revealed.

💊The study opens new avenues for the development of targeted treatments for autism.

📰 Nature @natureportfolio.bsky.social

✍️ Carla Garcia-Cabau, Anna Bartomeu et al.

➡️ bit.ly/3BfEGlR

📌 DOI: 10.1038/s41586-024-08289-w
December 4, 2024 at 4:00 PM