Erin Young
LightNews LightNews
banner
erinyoung.bsky.social
Erin Young
@erinyoung.bsky.social
3.5K followers 2.4K following 330 posts
Public Health #Bioinformatician. Wants to sequence ALL THE THINGS. Personal account with alternative spellings and grammar structures. She/her
Posts Replies Media Videos
erinyoung.bsky.social
Or little circular figures, also without connecting lines. I've found these impress people, but it is a little harder to identify sections of synteny when the genome is circular.
This circular genomic map visualizes the distribution of conserved BLAST hits across the ~155,000 bp length of test_3.fasta___3, where distinct colored blocks represent homology groups shared by at least two sequences. The sequence architecture is defined by extensive contiguous conservation at the termini, dominated by massive blocks such as Group_23 (orange) spanning the first 18kb and Group_6 (light blue) covering the final 20kb. In contrast to these stable ends, specific internal loci—most notably the 20,000–30,000 bp and 110,000–125,000 bp regions—exhibit a dense, mosaic arrangement of fragmented hits (e.g., Groups 11, 22, 16, and 21), indicating complex zones of variation or repetitive elements that align with the "hotspots" seen in the previous dot plot analysis.
November 21, 2025 at 11:41 PM
erinyoung.bsky.social
Or little synteny blocks figures without neighbors (no connecting lines). This is helpful in exploratory analysis where I am initially unsure which sequences are going to be significant.
This linear genomic map unfolds the test_3.fasta___3 sequence along a horizontal axis of approximately 155,000 base pairs, providing a flattened, chronological perspective of the BLAST hit distribution. The sequence architecture is anchored by substantial, contiguous homology blocks at the termini: the massive Group_23 (orange) dominates the first 18kb, while the extensive Group_6 (light blue) occupies the final segment from ~127kb onwards. Between these conserved flanks lies a segmented interior characterized by alternating patterns of stability—such as the large contiguous spans of Group_7 (purple) and Group_24 (mauve)—and highly fragmented "hotspots" (notably around 20kb–40kb and 100kb–125kb) where rapid transitions between numerous small groups (e.g., Groups 16, 12, 11, and 32) indicate regions of high complexity or genomic shuffling.
November 21, 2025 at 11:41 PM
erinyoung.bsky.social
I finally fleshed out one of my python scripts into a package: daisyblast

Instead of pairwise blast results, this is intended to find blast hits that are shared by _n_ queries (like a daisy chain!).

I can create dotplots of multiple samples
This combined alignment dot plot illustrates the syntenic relationships between the query sequence test_3.fasta___3 (x-axis) and four distinct subject sequences (y-axis), revealing a split between global collinearity and localized fragmentation. The subjects test_5.fasta___2 (dark blue) and test_4.fasta___3 (yellow) exhibit robust, nearly continuous diagonal alignments starting from the origin, indicating high homology and structural conservation with the query, though they diverge in coordinate space past the 100kb mark due to potential insertion/deletion events. Conversely, test_2.fasta___2 (light blue) and test_1.fasta___2 (orange) display discontinuous, "patchy" alignments clustered specifically around the 20,000 bp and 120,000 bp positions on the query; these high-coordinate matches (especially for the light blue sequence) are suggestive of translocated regions or shared repetitive motifs rather than continuous whole-sequence similarity.
November 21, 2025 at 11:41 PM
erinyoung.bsky.social
This is my first time working with NeighborNet (part of phangorn), and I think I'm going to need to do some reading so that 1) this makes sense to me, and 2) I can explain it to my collaborators
Phangorn's NeighborNet comparing 17 different phylogenetic trees. Tree tips are now web tips.
October 28, 2025 at 10:34 PM
erinyoung.bsky.social
I had an EPI contact me to see if any isolates were clustering with 2024CK-00004 and 2024CK-00250 for EPI reasons. Pathogen Detection has these two isolates in the same cluster, making this question relatively easy to answer.
A phylogenetic tree of pathogen detection cluster PDS000161821.27, which contains both isolates that initiated the investigation in red with additional isolates.
October 17, 2025 at 5:35 PM
erinyoung.bsky.social
I probably need some different colors, but I've made a graph detailing the number of AMR genes we've seen in organisms that we've sequenced for the last few months.
Stacked bargraph where the x-axis the year-month and the values are the number of bla*{NDM,OXA,VIM,GES,IMP,KPC}* genes identified in sequencing efforts that month. The legend is to the right in order for general matching of AMR gene to value.
October 16, 2025 at 6:10 PM
erinyoung.bsky.social
And today's (useless) figure is that the mean depth observed in a bam file is linearly associated with the number of reads in the corresponding fastq files.
A scatter plot comparing the number of reads and the overall mean depth observed in a bam file, which appears to have a linear relationship.
September 29, 2025 at 5:04 PM
erinyoung.bsky.social
I think you misunderstand. There is a lot of coverage for these samples. So much so that it is hard to see bubbles or other aberrations.
samtools coverage histogram of a SARS-CoV-2 sample with too many reads. The large grey box in the center should have more variation, but in general indicates that each and every base in the reference has a lot of read coverage.
September 23, 2025 at 8:46 PM
erinyoung.bsky.social
Mine does this too! The library reminds me that my kids would bankrupt me if I didn't have a library nearby.
Text in image: Total items: 9 You just saved $110.74 by using your library. You have saved $2,778.31 this past year and $7,108.25 since you began using the library! Account summary Items out: 40 Hold requests: 1 Items held: 0 Charges: $0.00 Thank You!
August 12, 2025 at 4:08 PM
erinyoung.bsky.social
Which gives me images like these. So far, these primers seems to be functional. /
A box plot where each box along the x-axis represents an amplicon and the y-axis is the mean read depth of that amplicon across a few samples.
August 8, 2025 at 9:03 PM
erinyoung.bsky.social
This primer scheme is different than the other schemes I've worked with because there are so many overlapping regions. For example, positions 412-433 of NC_001498.1 could be amplified by any of seven different primer pairs. /
screenshot for the primer bedfile with text and positions for each primer. The text in the shot is as follows: # artic-bed-version v3.0 NC_001498.1 1 26 177e6ebb_0_LEFT_0 1 + CCAAACAAAGTTGGGTAAGGATCGA NC_001498.1 412 435 177e6ebb_0_RIGHT_0 1 - ACTGGTCACTCTGAACAACCTCC NC_001498.1 412 435 177e6ebb_0_RIGHT_1 1 - ACTGGTCACTCTGGACAACCTCT NC_001498.1 412 434 177e6ebb_0_RIGHT_2 1 - CTGGTCACTCTGGACAACCTCC NC_001498.1 412 436 177e6ebb_0_RIGHT_3 1 - GACTGGTCACTCTGAACAACCTCT NC_001498.1 412 436 177e6ebb_0_RIGHT_4 1 - GATTGGTCACTCTGGACAACCTCT NC_001498.1 412 437 177e6ebb_0_RIGHT_5 1 - TGATTGGTCACTCTGGACAACTTCT NC_001498.1 412 433 177e6ebb_0_RIGHT_6 1 - TGGTCGCTCTGGACAACCTCT NC_001498.1 361 387 177e6ebb_1_LEFT_0 2 + CCAATTGATTCAGAGGATCACCGA
August 8, 2025 at 9:03 PM
erinyoung.bsky.social
I didn't mean to fail the internet!
A black cat glares at the photographer on top of some colorful polo shirts on the floor in front of a deep orange couch.
August 8, 2025 at 8:43 PM
erinyoung.bsky.social
Currently having an intern test how normalization impacts coverage for amplicon libraries. This one is normalized to 500X coverage.
Samtools plot ampliconstats image of a SARS-CoV-2 sample sequenced using Artic V5.3.2 primers after normalization. Each bar represents one amplicon (x-axis), and the y-axis (log scale) indicates the number of reads. Three types of read counts are shown: Purple bars: Total number of reads per amplicon (#reads) Yellow bars: All aligned read depth, regardless of quality (all depth) Blue bars: Reads meeting quality and alignment criteria (usable depth)
August 7, 2025 at 5:16 PM
erinyoung.bsky.social
I thought this facility had gotten their #CRPA under control, but two new patients appear to cluster with the ones from 2022 and 2023.

(Also, I work with some great epis who are on top of this in order to keep our healthcare facilities safe)

🧬🖥️🦠
Phylogenetic tree with two red dots designating new patients that appear to cluster with other patients.
May 13, 2025 at 4:26 PM
erinyoung.bsky.social
I didn't know dog rescues could team up with conferences, but it was pretty awesome to have some dogs attending #APHL2025
One dog in a purple vest and a black dog outside of it are getting petted by attendees of APHL 2025.
May 7, 2025 at 8:31 PM
erinyoung.bsky.social
Let #APHL2025 begin!
A large red heart with the word "OREG/ON" in the Oregon Convention Center. A blue sign for APHL 2025 is on the left next to it.
May 5, 2025 at 9:26 PM
erinyoung.bsky.social
Not to ruin the punchline, but the images of this preprint are top tier.
Part D of a figure showing the state of Massachusetts with the predicted spread of SARS-CoV-2 infections (COVID-19). Observed movements between each Massachusetts municipality. Line thickness corresponds to the number of movements observed.
April 9, 2025 at 7:23 PM
erinyoung.bsky.social
It's the end of an era. I wish they hadn't died on me.
A synology NAS and expansion sit on the floor next to a white filing cabinet in an office somewhere. No lights are on, and all bay doors are askew.
March 28, 2025 at 8:15 PM
erinyoung.bsky.social
My new conference buddy. I've named her Quanta (not original, but I feel it fits). #IDLabCon
A cute stuffed chameleon from Quanta bio sitting on a conference chair.
March 25, 2025 at 11:13 PM
erinyoung.bsky.social
Genomic Epi skill tree with classes and point values
March 24, 2025 at 7:29 PM
erinyoung.bsky.social
Sometimes, nanopore-only assemblies are just easier to use.
A green chromosomal sequence assembled by flye looks complete, but a unicycler assembly that still has non-circular colorful pieces and a supposedly complete green plasmid.
March 7, 2025 at 5:11 PM
erinyoung.bsky.social
One of *my* clusters on pathogen detection is PDS000214655, meaning almost every sequence was from submissions I've been involved in. Samples are from 2023-2025. 🧬🖥️🦠
A phylogenetic tree showing the relationship of sequences with some sample labels colored in red
February 28, 2025 at 5:12 PM
erinyoung.bsky.social
One my yearly highlights is meeting with young minds as a judge for a local STEM fair (previously called science fairs).

The future is bright my friends!
A banner for the Davis School District Science Technology Engineering Mathematics (STEM) Fair. Sponsored by Chevron.
February 25, 2025 at 6:22 PM
erinyoung.bsky.social
I've become a long-read snob. We sequenced this isolate (534,166 #ont reads with an average length of 2,611.5 bp), and I want to sequence the isolate again because I think we can resolve the plasmids better.
A bandage graph showing a large purple circle, which is likely representing the chromosomal sequence. Two circular objects below suggest closed plasmids. The jumbles lines and colorful rectangles in the lower left are the plasmid or plasmids that I think we can resolve further.
February 14, 2025 at 5:57 PM
erinyoung.bsky.social
We are soooo close to having COVID results in our LIMS system
A drop down menu with some green tube-ish icons. NGS_COV_SEQ [COVID Whole-genome Sequencing] - Run Name - Submission Accession - Non Ambiguous Bases - Passed QC - Nextclade Clade - Lineage
February 11, 2025 at 5:05 PM