James Cotton
@jamesacotton.bsky.social
560 followers 300 following 39 posts
I try and do comparative and population genomics of neglected tropical disease (and some other) parasites, as part of @sbohvm.gla.ac.uk at the @uofglasgow.bsky.social
Posts Media Videos Starter Packs
jamesacotton.bsky.social
My colleague Roz Laing also has a veterinary parasitology project next year, investigating how epigenetics might be involved in mediating drug resistance in parasitic nematodes www.gla.ac.uk/postgraduate....
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Roz Laing
www.gla.ac.uk
jamesacotton.bsky.social
#3 Developing improved molecular diagnostics for Cryptosporidium in drinking water, and using these (and some genomics) to understand sources of contamination. Led by Frank Katzer at Moredun and Willie Weir in Glasgow www.gla.ac.uk/postgraduate...
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - Willie Weir
www.gla.ac.uk
jamesacotton.bsky.social
#2 - a project taking a comparative approach to DNA replication and plasticity/mutation in kinetoplastids, expanding work form the 'model' parasites to other kinetoplastid lineages, with Richard McCulloch and Sarah Allinson in Lancaster: www.gla.ac.uk/postgraduate...
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch
www.gla.ac.uk
jamesacotton.bsky.social
I'm also co-supervising a few other projects:
#1: an inter-disciplinary project on chemical biology of Base-J in kinetoplastids, led by Glenn Burley @Strathclyde. We aim to develop some new chemical approaches and apply them to study kinetoplastid genetics.
www.gla.ac.uk/postgraduate...
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Underpinning Bioscience - Glenn A Burley
www.gla.ac.uk
jamesacotton.bsky.social
We have a PhD position in population genomics of sheep scab mites available from October 2026. The project will investigate Psoroptes populations in the context of eradication programs on Scottish island groups and spreading drug resistance. www.gla.ac.uk/postgraduate...
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - James Cotton
www.gla.ac.uk
jamesacotton.bsky.social
Univariate Regression Road
Non-Parametric Parade

If I ever build a housing estate, there will be no 'Oak Avenue'
jamesacotton.bsky.social
Well done Lilly!
bavet-parasitol.bsky.social
🏆BAVP ECR Winners of Best Introductory Presentation🏆

Victoria Allicock 🐐 @uofguelph.bsky.social

Lilly Atkins 🐮 @uofglasgow.bsky.social
jamesacotton.bsky.social
Well done Benedict!
bavet-parasitol.bsky.social
🏆 BAVP ECR Winner of Best Research Presentation🏆

Benedict Karani-
‘Genome-wide analysis of T. circ from different treatment regimes reveals stronger selection for ivermectin resistance in frequently treated lambs’
🐑🪱

@uofglasgow.bsky.social
@moredunfoundation.bsky.social
Reposted by James Cotton
drjenirwin.bsky.social
Academic colleagues, if we claim to value equity, and if it’s currently not safe for *some* of our colleagues to travel to the US for conferences, then should *any* of us be travelling to the US? Standing up for equity isn’t about our own convenience.
jamesacotton.bsky.social
Possibly limited engagement. Does your network on here reach enough trilobite systematics influencers?
jamesacotton.bsky.social
not completely, but its good that you are so motivated to look less like me.
jamesacotton.bsky.social
Did you notice any way people can donate to the 'debt buying company' or similar things? Obviously I don't know the numbers but it seems like could be quite cost-effective philanthropy.

We almost look like twins in our bsky profile pictures.. 😧
Reposted by James Cotton
trevorcotton.bsky.social
@mchshe.bsky.social Reading the Guardian this morning. You seem to be a good man. Your comment on powerlessness really resonated… I need to do more, and am fortunate enough to be able to make some small difference. Well done!
jamesacotton.bsky.social
Tapeworm Echinococcus multilocularis: TCGGTCCTTACCTTGCAGTTTTGTATG
doi: 10.1074/jbc.M006091200.

tapeworm Hymenolepis diminuita:
SL1: CGGTCTTACCATAAAACTTGTATG
SL2: CCGGTCTTACCTTGCAATTTTTGTATG
SL3: AATCGGTCTTACTGTACTAACTTGTATG
doi: 10.1186/s12915-020-00899-w.

thats all I can think of just now.
jamesacotton.bsky.social
No worries - i'd forgotten the nematode literature on this so nice to remind myself. You did say 'keep it coming'.
jamesacotton.bsky.social
The plant nematode Globodera pallida and G. rostochiensis have a bunch of different SLs (van Bers NEM: Characterization of genes coding for small hypervariable peptides in Globodera rostochiensis, PhD thesis. 2008, Wageningen (our paper doi.org/10.1186/gb-2... confirms this G. pallida, table S6)
jamesacotton.bsky.social
The plant parasitic nematode Heterodera glycines has a bunch of alternative SLs too: (from doi.org/10.1038/s415...)
jamesacotton.bsky.social
There are a bunch of other SL sequences in C. elegans that are used less commonly than SL1 and SL2 - the table here is from International Journal of Parasitology Vol. 26. No. IO, pp. 1025-1033. 1996
jamesacotton.bsky.social
no worries - if i come across a good synthesis of the complex nematode ones I'll let you know. There is also trans-splicing in other flatworms, but not sure what the sequences are. It must be known in some e.g. Echinococcus and Hymenolepis, and probably Fasciola too.